Understudies can discover the chapter astute vital questions for course 12th Biology within the table underneath. These imperative questions incorporate questions that are regularly inquired in a long time. Moreover, arrangements are to give for these questions, with extraordinary accentuation on ease-of-study. Tap on the joins underneath to begin investigating.
Case Study Question for Class 12 Biology Ch 1 to 16
Case Study 01:
Some restriction enzymes break a phosphodiester bond on both the DNA strands, such that only one end of each molecule is cut and these ends have regions of single stranded DNA. BamH1is one such restriction enzyme which binds at the recognition sequence, 5’-GGATCC- 3’and cleaves these sequences just after the 5’- guanine on each strand. (CBSE Sample Paper 2022)
(a) What is the objective of this action?
Ans: The two different DNA molecules will have compatible ends to recombine.
(b) Explain how the gene of interest is introduced into a vector.
Ans: Restriction enzyme cuts the DNA of the vector and then ligates the gene of interest into the DNA of the vector.
(c) You are given the DNA shown below.
5’ ATTTTGAGGATCCGTAATGTCCT 3’
3’ TAAAACTCCTAGGCATTACAGGA 5’
If this DNA was cut with BamHI, how many DNA fragments would you expect? Write the sequence of these double-stranded DNA fragments with their respective polarity.
Ans: 2 fragments
5’ ATTTTGAG 3’5’GATCCGTAATGTCCT 3’
3’ TAAAACTCCTAG 5’.3’GCATTACAGGA 5’
(d) A gene M was introduced into E.coli cloning vector PBR322 at BamH1 site. What will be its impact on the recombinant plamids?
Give a possible way by which you could differentiate non recombinant to recombinant plasmids.
Ans: BamH1 site will affect tetracycline antibiotic resistance gene, hence the recombinant plasmids will lose tetracycline resistance due to inactivation of the resistance gene
Recombinants can be selected from non recombinants by plating into a medium containing tetracycline, as the recombinants will not grow in the medium because the tetracycline resistance gene is cut.
Case Study 02:
GM crops especially Bt crops are known to have higher resistance to pest attacks. To substantiate this an experimental study was conducted in 4 different farmlands growing Bt and non Bt-Cotton crops. The farm lands had the same dimensions, fertility and were under similar climatic conditions. The histogram below shows the usage of pesticides on Bt crops and non-Bt crops in these farm lands. (CBSE Sample Paper 2022)
(a) Which of the above 4 farm lands has successfully applied the concepts of Biotechnology to show better management practices and use of agrochemicals? If you had to cultivate, which crop would you prefer (Bt or Non- Bt) and why?
Ans: Farm Land II.
Bt crop.
Because the use of pesticides is highly reduced for Bt crop // Decrease of pesticide used is also more significant for Bt crop.
(b) Cotton Bollworms were introduced in another experimental study on the above farm lands wherein no pesticide was used. Explain what effect would a Bt and Non Bt crop have on the pest.
Ans: In Bt cotton a cry gene has been introduce from bacterium Bacillus thuringiensis (Bt) which causes synthesis of a toxic protein. This protein becomes active in the alkaline gut of bollworm feeding on cotton, punching holes in the lining causing death of the insect
However; a Non Bt crop will have no effect on the cotton bollworm/ the yield of cotton will decrease / non Bt will succumb to pest attack.
Case Based Questions Class 12 Biology Chapterwise
Chapter 1 | Reproduction in Organisms | Chapter 9 | Strategies for Enhancement in Food Production |
Chapter 2 | Sexual Reproduction in Flowering Plants | Chapter 10 | Microbes in Human Welfare |
Chapter 3 | Human Reproduction | Chapter 11 | Biotechnology: Principles And Processes |
Chapter 4 | Reproductive Health | Chapter 12 | Biotechnology and its Applications |
Chapter 5 | Principles of Inheritance and Variation | Chapter 13 | Organisms and Populations |
Chapter 6 | Molecular Basis of Inheritance | Chapter 14 | Ecosystem |
Chapter 7 | Evolution | Chapter 15 | Biodiversity and Conservation |
Chapter 8 | Human Health and Disease | Chapter 16 | Environmental Issues |
Key questions for 10th review Biology are outlined agreeing to the CBSE NCERT program. All address sorts are accessible within the PDF, from one-word to one-line answers, brief reply sorts to five point long reply sorts. Hence, understudies can plan for exams and indeed clarify their concepts through them. On the off chance that they refer to these questions, it’ll get ready their minds to pick up a competitive advantage. Understudies will gotten to be commonplace with question patterns and the sorts of questions that will show up on exams.